Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
DPYSL2 (1 of 2)
- Ensembl ID:
- ENSDARG00000038974
- Description:
- dihydropyrimidinase-like 2 [Source:HGNC Symbol;Acc:3014]
- Human Orthologue:
- DPYSL2
- Human Description:
- dihydropyrimidinase-like 2 [Source:HGNC Symbol;Acc:3014]
- Mouse Orthologue:
- Dpysl2
- Mouse Description:
- dihydropyrimidinase-like 2 Gene [Source:MGI Symbol;Acc:MGI:1349763]
Alleles
There are 4 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa7118 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa34289 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa2444 | Essential Splice Site | F2 line generated | During 2018 |
| sa5769 | Essential Splice Site | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa7118
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000056885 | Nonsense | 168 | 573 | 5 | 14 |
- Genomic Location (Zv9):
- Chromosome 8 (position 5362588)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 5296750 GRCz11 8 5145487 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTTCTCTNTTTTTTTTTTTTTTTACAGGYGTCAACTYTTTTCTGGTCTA[T/A]CTGGCGTACAAAGACATCTTCCAGCTCAATGATTCCCAGGTAAACAACAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34289
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000056885 | Essential Splice Site | 488 | 573 | 12 | 14 |
| ENSDART00000056885 | Essential Splice Site | 488 | 573 | 12 | 14 |
| ENSDART00000056885 | Essential Splice Site | 488 | 573 | 12 | 14 |
- Genomic Location (Zv9):
- Chromosome 8 (position 5342554)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 5315983 GRCz11 8 5126254 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCAAACCCTTCCCAGACTACGTCTACAAGAGGATAAAGGCCCGCAGCAGG[G/T]TACATGCATGCACTCACACACACATCCAGACATTGTGGTTTTAAAAAGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa2444
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000056885 | Essential Splice Site | 488 | 573 | 12 | 14 |
| ENSDART00000056885 | Essential Splice Site | 488 | 573 | 12 | 14 |
| ENSDART00000056885 | Essential Splice Site | 488 | 573 | 12 | 14 |
- Genomic Location (Zv9):
- Chromosome 8 (position 5342554)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 5315983 GRCz11 8 5126254 - KASP Assay ID:
- 554-3062.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCAAACCCTTCCCAGACTACGTCTACAAGAGGATAAAGGCCCGCAGCAGG[G/A]TACATGCATGCACTCACACACACATCCAGACATTGTGGTTTTAAAAAGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5769
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000056885 | Essential Splice Site | 488 | 573 | 12 | 14 |
| ENSDART00000056885 | Essential Splice Site | 488 | 573 | 12 | 14 |
| ENSDART00000056885 | Essential Splice Site | 488 | 573 | 12 | 14 |
- Genomic Location (Zv9):
- Chromosome 8 (position 5342554)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 5315983 GRCz11 8 5126254 - KASP Assay ID:
- 554-3062.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCAAACCCTTCCCAGACTACGTCTACAAGAGGATAAAGGCCCGCAGCAGG[G/A]TACATGCATGCACTCACACACACATCCAGACATTGTGGTTTTAAAAAGCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
