zgc:113142

Ensembl ID:
ENSDARG00000038969
ZFIN ID:
ZDB-GENE-050220-2
Description:
hypothetical protein LOC503524 [Source:RefSeq peptide;Acc:NP_001012506]
Human Orthologues:
BDH1, HSD11B2, HSD17B2
Human Descriptions:
3-hydroxybutyrate dehydrogenase, type 1 [Source:HGNC Symbol;Acc:1027]
hydroxysteroid (11-beta) dehydrogenase 2 [Source:HGNC Symbol;Acc:5209]
hydroxysteroid (17-beta) dehydrogenase 2 [Source:HGNC Symbol;Acc:5211]
Mouse Orthologues:
Bdh1, Hsd11b2, Hsd17b2
Mouse Descriptions:
3-hydroxybutyrate dehydrogenase, type 1 Gene [Source:MGI Symbol;Acc:MGI:1919161]
hydroxysteroid (17-beta) dehydrogenase 2 Gene [Source:MGI Symbol;Acc:MGI:1096386]
hydroxysteroid 11-beta dehydrogenase 2 Gene [Source:MGI Symbol;Acc:MGI:104720]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36541 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9901 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36541
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056886 Essential Splice Site 129 359 2 5
Genomic Location (Zv9):
Chromosome 17 (position 52159474)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51544129
GRCz11 17 51633164
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATATCAGCTCAGCCAAGGATTTTGTAGAAGCAAACTTGCCAGTGAAAGG[T/G]AACTCAACGCTGAAAGAACCAAATACAGGAAAATGCAGCAACAAAAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9901
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056886 Nonsense 154 359 3 5
Genomic Location (Zv9):
Chromosome 17 (position 52159895)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51544550
GRCz11 17 51633585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTKGCRTCAGTGACTGGGGCGAGACGGAGTGGAGTACGGCTGAGGACTTC[C/T]AGAAGATGGCSGATGTGAACCTGTTCGGCGCCATCAGAGTCACCATCMCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link