ssfa2

Ensembl ID:
ENSDARG00000038938
ZFIN ID:
ZDB-GENE-090824-1
Description:
Ssfa2 protein [Source:UniProtKB/TrEMBL;Acc:Q1RLZ1]
Human Orthologue:
SSFA2
Human Description:
sperm specific antigen 2 [Source:HGNC Symbol;Acc:11319]
Mouse Orthologue:
Ssfa2
Mouse Description:
sperm specific antigen 2 Gene [Source:MGI Symbol;Acc:MGI:1917849]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34754 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34754
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056844 Nonsense 158 436 2 8
Genomic Location (Zv9):
Chromosome 9 (position 45470390)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44602325
GRCz11 9 44404067
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACACACCCATGGACAGGATCGGCACACCGCGCTCCGTCCAACCGCTTTA[C/A]GAGGTACATCATTTCCCAAAGAGGAAGCAGTCACATGCTAGTTTGATTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link