zgc:113691

Ensembl ID:
ENSDARG00000038898
ZFIN ID:
ZDB-GENE-050220-7
Description:
hypothetical protein LOC503529 [Source:RefSeq peptide;Acc:NP_001012511]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19772 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056787 Nonsense 211 233 2 2
ENSDART00000134685 Nonsense 212 234 2 2
Genomic Location (Zv9):
Chromosome 2 (position 26740395)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26936591
GRCz11 2 26592225
KASP Assay ID:
2259-2067.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGCTCAGCTCAGATTTTACCCACGAACGCCTTCGAGACCAAGAACCGC[C/T]GAGACCTCGATAAAAGCAGAACCAGCCTGGAGAGACGCAACATCACTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link