
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000038872
- Ensembl ID:
- ENSDARG00000038872
- Human Orthologue:
- ZBED1
- Human Description:
- zinc finger, BED-type containing 1 [Source:HGNC Symbol;Acc:447]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa7099 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa34222 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa41066 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa7099
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061380 | Nonsense | 241 | 524 | 2 | 3 |
ENSDART00000121413 | Nonsense | 228 | 511 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 7 (position 65802089)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 58983829 GRCz11 7 59286259 - KASP Assay ID:
- 554-4905.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGCACAGAAGSCCCTAAATTTACCAGTACATTCCCTCATATCAGAATGY[C/T]AAACAAGATGGGGTTCCAGACAGATGATGATCAGCAGRATTTTAGAGCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34222
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061380 | Nonsense | 284 | 524 | 2 | 3 |
ENSDART00000121413 | Nonsense | 271 | 511 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 7 (position 65801959)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 58983699 GRCz11 7 59286129 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGACAAGAAGGCAAGGCATCTGATTCAAACCTGGCAAGATATAGATGTCT[T/A]GGAATCTGTCAGCAAGACACTGGGCCCACTACTGGATTTCACAGATGCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41066
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061380 | Nonsense | 311 | 524 | 2 | 3 |
ENSDART00000121413 | Nonsense | 298 | 511 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 7 (position 65801877)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 58983617 GRCz11 7 59286047 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGGATTTCACAGATGCACTCTCAGGAGAAGATTATGTTAGTGTCTCCTA[T/A]GTGAAGCCAGTTCTTCACCTCTTCAACACTTCAATGCTATTAACGCATGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: