slu7

Ensembl ID:
ENSDARG00000038870
ZFIN ID:
ZDB-GENE-041114-62
Description:
Pre-mRNA-splicing factor SLU7 [Source:UniProtKB/Swiss-Prot;Acc:Q5U3F2]
Human Orthologue:
SLU7
Human Description:
SLU7 splicing factor homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:16939]
Mouse Orthologue:
Slu7
Mouse Description:
SLU7 splicing factor homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2385598]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35757 Nonsense Mutation detected in F1 DNA During 2018
sa22543 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021319 Nonsense 270 571 9 16
ENSDART00000141545   None 184 None 6
ENSDART00000145241 Nonsense 318 619 9 16
Genomic Location (Zv9):
Chromosome 14 (position 48945976)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47023635
GRCz11 14 46010927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTTATTGTACAGTACCTCAGAAATCTGGATCCAAACTCCGCCTACTA[C/A]GATCCTAAGACTCGAGCCATGAGGGAGAACCCATACTCCAACACTGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22543
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021319 Essential Splice Site 475 571 15 16
ENSDART00000141545 Essential Splice Site 118 184 5 6
ENSDART00000145241 Essential Splice Site 523 619 15 16
Genomic Location (Zv9):
Chromosome 14 (position 48951053)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47028712
GRCz11 14 46016004
KASP Assay ID:
2260-7904.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACTCCACAATGTCTGAAGATGATTGCGTTAAACTGAAACGTTTTCAC[A/T]GATGCACCAGGAAAAATTGAAAGACAAGAAAAAGAAGAAAAAGAGCAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link