acox3

Ensembl ID:
ENSDARG00000038865
ZFIN ID:
ZDB-GENE-040426-2163
Description:
peroxisomal acyl-coenzyme A oxidase 3 [Source:RefSeq peptide;Acc:NP_998312]
Human Orthologue:
ACOX3
Human Description:
acyl-CoA oxidase 3, pristanoyl [Source:HGNC Symbol;Acc:121]
Mouse Orthologue:
Acox3
Mouse Description:
acyl-Coenzyme A oxidase 3, pristanoyl Gene [Source:MGI Symbol;Acc:MGI:1933156]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34214 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34214
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056745 Essential Splice Site 442 619 10 14
Genomic Location (Zv9):
Chromosome 7 (position 62425576)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 61465466
GRCz11 7 61775628
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTATTCAGGAATGTCGAGAGGCCTGTGGAGGACACGGTTACCTTGCCAG[T/C]GAGGAATTCCTAAAAGCTTCATTGGCTAAATATTGCTCATAAACACCATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link