
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
myrip
- Ensembl ID:
- ENSDARG00000038814
- ZFIN ID:
- ZDB-GENE-080123-1
- Description:
- A kinase-anchoring protein [Source:UniProtKB/TrEMBL;Acc:A8T6P4]
- Human Orthologue:
- MLPH
- Human Description:
- melanophilin [Source:HGNC Symbol;Acc:29643]
- Mouse Orthologue:
- Mlph
- Mouse Description:
- melanophilin Gene [Source:MGI Symbol;Acc:MGI:2176380]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30053 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa37835 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa44098 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa14099 | Nonsense | Available for shipment | Available now |
sa7514 | Missense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa30053
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082301 | Essential Splice Site | 362 | 838 | 8 | 11 |
ENSDART00000113420 | Essential Splice Site | 362 | 1118 | 8 | 15 |
ENSDART00000137257 | None | 300 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 24 (position 10921896)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 11009299 GRCz11 24 11149666 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCATTATCACTTCCTGGATGGAAGAGTGTTGACCGCCTTGAAAACTCCAG[T/A]AAGAGCATGTAAACAGACAAACACAACTGTAAGATGAATTCAACTGCACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37835
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082301 | Nonsense | 430 | 838 | 9 | 11 |
ENSDART00000113420 | Nonsense | 430 | 1118 | 9 | 15 |
ENSDART00000137257 | None | 300 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 24 (position 10917758)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 11005161 GRCz11 24 11145528 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTCAGATTCAGACCCTGAGGATCAGGGTGGATGGGGCGCTGCCTTGTTA[C/T]AGTTTCGCAGACGTCTCTCTGATGAAACATACTATACTGACTCTCAACAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44098
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082301 | Nonsense | 813 | 838 | 10 | 11 |
ENSDART00000113420 | Nonsense | 813 | 1118 | 10 | 15 |
ENSDART00000137257 | None | 300 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 24 (position 10913571)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 11000974 GRCz11 24 11141341 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGTCGAGAAGAAACAGGAAAGACAGAAAGAAATGGAGAAACAACTGAAA[C/T]AAGAACAAGAGAGACAATCAGAGATTGAGCGAGACTTAGAAAAGAAAAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14099
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082301 | Nonsense | 830 | 838 | 10 | 11 |
ENSDART00000113420 | Nonsense | 830 | 1118 | 10 | 15 |
ENSDART00000137257 | None | 300 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 24 (position 10913520)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 11000923 GRCz11 24 11141290 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGAACAAGAGAGACAATCAGAGATTGAGCGAGACTTAGAAAAGAAAAGG[A/T]AAAGCATACGAATGGAAAAAGAGAAATTAGTGAGTGKGAAATCCAGAGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7514
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082301 | None | 838 | None | 11 | |
ENSDART00000113420 | Missense | 938 | 1118 | 11 | 15 |
ENSDART00000137257 | None | 300 | None | 7 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 24 (position 10899687)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 10987090 GRCz11 24 11127457 - KASP Assay ID:
- 554-4289.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTGGTGGATGTGGAGCAGAAGTAYTCTGCTGCGTCTTTATGCAGCATCA[C/T]CACAGAGGTTCTGAAGGTCCTAAACGCCACAGAGGATTTGCTTGGTGARG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Prostate cancer: Genome-wide association study identifies new prostate cancer susceptibility loci. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: