
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:113531
- Ensembl ID:
- ENSDARG00000038794
- ZFIN ID:
- ZDB-GENE-050320-52
- Description:
- hypothetical protein LOC541359 [Source:RefSeq peptide;Acc:NP_001013504]
- Human Orthologues:
- VWC2, VWC2L
- Human Descriptions:
- von Willebrand factor C domain containing 2 [Source:HGNC Symbol;Acc:30200]
- von Willebrand factor C domain-containing protein 2-like [Source:HGNC Symbol;Acc:37203]
- Mouse Orthologues:
- Vwc2, Vwc2l
- Mouse Descriptions:
- von Willebrand factor C domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2442987]
- von Willebrand factor C domain-containing protein 2-like Gene [Source:MGI Symbol;Acc:MGI:2444069]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18616 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa18616
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056657 | Nonsense | 17 | 220 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 2 (position 33175419)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 33474326 GRCz11 2 33457544 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATGATGGGCATGGCTTTTCTCTGTGGTTCCCCTGTGACTTTTYGTGTCTG[G/A]CTGACTTTGCTGATCTCCGGCTATCCTGCTCTGGCTTTTTCGGTCGCTGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: