zgc:113531

Ensembl ID:
ENSDARG00000038794
ZFIN ID:
ZDB-GENE-050320-52
Description:
hypothetical protein LOC541359 [Source:RefSeq peptide;Acc:NP_001013504]
Human Orthologues:
VWC2, VWC2L
Human Descriptions:
von Willebrand factor C domain containing 2 [Source:HGNC Symbol;Acc:30200]
von Willebrand factor C domain-containing protein 2-like [Source:HGNC Symbol;Acc:37203]
Mouse Orthologues:
Vwc2, Vwc2l
Mouse Descriptions:
von Willebrand factor C domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2442987]
von Willebrand factor C domain-containing protein 2-like Gene [Source:MGI Symbol;Acc:MGI:2444069]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18616 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056657 Nonsense 17 220 1 3
Genomic Location (Zv9):
Chromosome 2 (position 33175419)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33474326
GRCz11 2 33457544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATGGGCATGGCTTTTCTCTGTGGTTCCCCTGTGACTTTTYGTGTCTG[G/A]CTGACTTTGCTGATCTCCGGCTATCCTGCTCTGGCTTTTTCGGTCGCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link