ccdc24

Ensembl ID:
ENSDARG00000038793
ZFIN ID:
ZDB-GENE-050327-18
Description:
coiled-coil domain-containing protein 24 [Source:RefSeq peptide;Acc:NP_001014330]
Human Orthologue:
CCDC24
Human Description:
coiled-coil domain containing 24 [Source:HGNC Symbol;Acc:28688]
Mouse Orthologue:
Ccdc24
Mouse Description:
coiled-coil domain containing 24 Gene [Source:MGI Symbol;Acc:MGI:2685874]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32956 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa45107 Splice Site, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32956
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056656 Essential Splice Site 203 229 None 7
ENSDART00000114573 Essential Splice Site 203 397 None 8
ENSDART00000132221 Missense 204 210 6 6
ENSDART00000134024 Essential Splice Site 203 280 None 8
Genomic Location (Zv9):
Chromosome 2 (position 33152553)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33451460
GRCz11 2 33434678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGACTGAAGAATCTGAAGCTTTGAGAAAAGATGTGCAGGCCTTGCAGG[T/C]AAGGGCTTATTTTGACGTTAATTACTGGTTTTGATTGCAACATCGATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056656 Nonsense 228 229 6 7
ENSDART00000114573 Splice Site None 397 None 8
ENSDART00000132221   None 209 None 6
ENSDART00000134024 Splice Site None 280 None 8
Genomic Location (Zv9):
Chromosome 2 (position 33143582)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33442489
GRCz11 2 33425707
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTACTCAGACAGAGCCTGTGTGCCCTGAACCCACATTAGCAGGTACATG[G/A]AGTTAATCCTGACAAATGACATTGGTTTCATGGCAGTTTTTTGGAGCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link