klf4

Ensembl ID:
ENSDARG00000038792
ZFIN ID:
ZDB-GENE-010129-1
Description:
Kruppel-like factor 4 [Source:RefSeq peptide;Acc:NP_571798]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39866 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9224 Nonsense Mutation detected in F1 DNA During 2018
sa39867 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056655 Essential Splice Site 30 409 2 3
Genomic Location (Zv9):
Chromosome 2 (position 33044985)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33343892
GRCz11 2 33327110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGCAGAAATAAGCAGTCTAAGTCGAAAGTTGTGTTTTCTTTTTCTCC[A/T]GGACTGGAAAGTTGATATAGCAAAAACTAACCCAAGGGCTGGAGACGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9224
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056655 Nonsense 268 409 2 3
Genomic Location (Zv9):
Chromosome 2 (position 33045701)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33344608
GRCz11 2 33327826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGCAGTTTATAAACAATGCGCATTTTCCACCTCAGTACGCCCAGCAT[C/T]AACAGTACCACGGACATTTTAATATGTTTAGCGAACCRCTGCGGGCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39867
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056655 Nonsense 337 409 2 3
Genomic Location (Zv9):
Chromosome 2 (position 33045910)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33344817
GRCz11 2 33328035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGGACCGCGACGCACAGTTGTGAATTCCCTGGATGCGGGAAAACGTA[C/A]ACGAAAAGCTCCCATTTGAAAGCGCACATGCGGACGCACACAGGTATGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link