zgc:92204

Ensembl ID:
ENSDARG00000038789
ZFIN ID:
ZDB-GENE-040718-384
Description:
Transmembrane protein 53 [Source:UniProtKB/Swiss-Prot;Acc:Q6DHN0]
Human Orthologue:
TMEM53
Human Description:
transmembrane protein 53 [Source:HGNC Symbol;Acc:26186]
Mouse Orthologue:
Tmem53
Mouse Description:
transmembrane protein 53 Gene [Source:MGI Symbol;Acc:MGI:1916027]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39865 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056649 Nonsense 75 281 3 3
Genomic Location (Zv9):
Chromosome 2 (position 32567575)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32866482
GRCz11 2 32849700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTACACGGCTCCTTTAAAGACGGTTTTTATTTCAGAATCATTGGGCTA[C/A]AAGGAGCTAAGAAGCACTGCACACAAACTACTCGAACTTCTGTATGACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link