zgc:158666

Ensembl ID:
ENSDARG00000038788
ZFIN ID:
ZDB-GENE-070112-1302
Description:
dynein intermediate chain 1, axonemal [Source:RefSeq peptide;Acc:NP_001074027]
Human Orthologue:
DNAI1
Human Description:
dynein, axonemal, intermediate chain 1 [Source:HGNC Symbol;Acc:2954]
Mouse Orthologue:
Dnaic1
Mouse Description:
dynein, axonemal, intermediate chain 1 Gene [Source:MGI Symbol;Acc:MGI:1916172]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43615 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11518 Essential Splice Site Available for shipment Available now
sa15293 Splice Site, Nonsense Available for shipment Available now
sa17473 Nonsense Available for shipment Available now
sa37269 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43615
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080431 Essential Splice Site 14 660 1 18
ENSDART00000142468   None 150 None 7
Genomic Location (Zv9):
Chromosome 21 (position 16468566)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 17920345
GRCz11 21 17956981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAAAATGTCAGTTTCTTATAAAGTTGGGACAGTGAAAAGTAAACAGG[T/A]ATGTAAATAGCATTATAACGAACGCAGATTTAATACTATCGTAAAAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11518
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080431 Essential Splice Site 69 660 3 18
ENSDART00000142468 Essential Splice Site 18 150 3 7
Genomic Location (Zv9):
Chromosome 21 (position 16469012)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 17920791
GRCz11 21 17957427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGAAAAACCCTTGTGAAGCCTCCAGACCAGCTSGACTTAACTGAAGAA[G/A]TGTGTAAACCTGAATAGAGCCTGTGGTCTGACTCTGCATCTAATAATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15293
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080431 Splice Site, Nonsense 407 660 11 18
ENSDART00000142468   None 150 None 7
Genomic Location (Zv9):
Chromosome 21 (position 16471700)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 17923479
GRCz11 21 17960115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGTATAACAGCATAGCCAGCTCTGGCAAACACACAGGAGCTGTGTGG[C/T]AGGTATGGGTGATGATGTGACCATGGTGTCATTGTTAACTTAAAGCAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17473
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080431 Nonsense 473 660 14 18
ENSDART00000142468   None 150 None 7
Genomic Location (Zv9):
Chromosome 21 (position 16474349)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 17926128
GRCz11 21 17962764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTYATAACACTTTCTCTATGGGTCTAGCTGGAACATCTTTGGATTTTCAT[A/T]AACAAAAGGACCACCATTTTCTGGTTGGCACTGAAGCTGGAAAGATTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080431 Nonsense 474 660 14 18
ENSDART00000142468   None 150 None 7
Genomic Location (Zv9):
Chromosome 21 (position 16474352)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 17926131
GRCz11 21 17962767
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACACTTTCTCTATGGGTCTAGCTGGAACATCTTTGGATTTTCATAAA[C/T]AAAAGGACCACCATTTTCTGGTTGGCACTGAAGCTGGAAAGATTCACAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link