tmub1

Ensembl ID:
ENSDARG00000038787
ZFIN ID:
ZDB-GENE-040426-2504
Description:
Transmembrane and ubiquitin-like domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6P135
Human Orthologue:
TMUB1
Human Description:
transmembrane and ubiquitin-like domain containing 1 [Source:HGNC Symbol;Acc:21709]
Mouse Orthologue:
Tmub1
Mouse Description:
transmembrane and ubiquitin-like domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1923764]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39863 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056642 Nonsense 160 292 2 3
Genomic Location (Zv9):
Chromosome 2 (position 32287450)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32586357
GRCz11 2 32569575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGACACCCACAGAAACATGGTGCTCAGGCTGAAGTTCTTGAATGATACC[G/T]AGAGGACAGCGCAGGTCAATCCTCAAGACACCATTGGTTATATTAAACGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link