smarcd3a

Ensembl ID:
ENSDARG00000038786
ZFIN ID:
ZDB-GENE-070912-491
Human Orthologue:
SMARCD3
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 [S
Mouse Orthologue:
Smarcd3
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 Ge

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8474 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8474
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056641 Nonsense 332 505 9 14
ENSDART00000137531 Nonsense 302 475 8 13
ENSDART00000140026 Nonsense 280 453 8 13
ENSDART00000145603   None 180 None 5
Genomic Location (Zv9):
Chromosome 2 (position 32237505)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32536412
GRCz11 2 32519630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAAGCTGCAGGAYTCTCATGAGAAAGAGTACATCAACTGTGAKAAATA[T/A]TTCCAGCAGGTGCTGCCYTTCTTCTGCCATATGAAGGACTCTCTTCATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link