zgc:110143

Ensembl ID:
ENSDARG00000038784
ZFIN ID:
ZDB-GENE-050320-88
Description:
fas apoptotic inhibitory molecule 2 [Source:RefSeq peptide;Acc:NP_001013536]
Human Orthologue:
FAIM2
Human Description:
Fas apoptotic inhibitory molecule 2 [Source:HGNC Symbol;Acc:17067]
Mouse Orthologue:
Faim2
Mouse Description:
Fas apoptotic inhibitory molecule 2 Gene [Source:MGI Symbol;Acc:MGI:1919643]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15600 Essential Splice Site Available for shipment Available now
sa19800 Nonsense Available for shipment Available now
sa14757 Nonsense Available for shipment Available now
sa25840 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056639 Essential Splice Site None 306 None 12
ENSDART00000141884 Essential Splice Site None 204 None 9
Genomic Location (Zv9):
Chromosome 2 (position 32222938)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32521845
GRCz11 2 32505063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTGTTTTTGCTTGGGAATAGCGACTAACGTTCGCCGTTACAGTAAGG[T/A]AAGTTAAAATGTATWACTCTGTCTGCAGTTCAYTAGCTAYAGCCTGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19800
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056639 Nonsense 104 306 4 12
ENSDART00000141884 Nonsense 104 204 4 9
Genomic Location (Zv9):
Chromosome 2 (position 32215982)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32514889
GRCz11 2 32498107
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGAAAGGCATCCGTCTTGTTTGCAGGTCTTCTGTATTCTCATGGTA[C/T]AGCTCATGGTTACGTTTAGTGTGGTGTCGCTCTTCACATTTTGGTAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14757
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056639 Nonsense 132 306 5 12
ENSDART00000141884 Nonsense 132 204 5 9
Genomic Location (Zv9):
Chromosome 2 (position 32215791)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32514698
GRCz11 2 32497916
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTACAGTGAGCCGGTCCGCAAGTTTGTACAGTATAATCGGGTTTTCTA[T/A]CTGACCTCATAGTAAGTGCTGCTCTCTTTCATCTTTACATGTTTAATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056639 Essential Splice Site 208 306 9 12
ENSDART00000141884   None 204 None 9
Genomic Location (Zv9):
Chromosome 2 (position 32214700)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32513607
GRCz11 2 32496825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGCTCTGGTGTGTCTGGCCATCACTCTCTTCTGTTTCCAGTCCAGGG[T/C]GAGCAATTATTTTTTGTAAATCAGTCTTTTCGAGTGCTTTCTTTATGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link