zgc:103625

Ensembl ID:
ENSDARG00000038770
ZFIN ID:
ZDB-GENE-040912-116
Description:
UPF0585 protein C16orf13 homolog B [Source:UniProtKB/Swiss-Prot;Acc:Q66I74]
Human Orthologue:
C16orf13
Human Description:
chromosome 16 open reading frame 13 [Source:HGNC Symbol;Acc:14141]
Mouse Orthologue:
0610011F06Rik
Mouse Description:
RIKEN cDNA 0610011F06 gene Gene [Source:MGI Symbol;Acc:MGI:1915597]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20126 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20126
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056619 Essential Splice Site 67 205 2 7
Genomic Location (Zv9):
Chromosome 3 (position 47695545)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 49034672
GRCz11 3 50069940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTTGTGACATGGCTACCTTCAGACACCAAGGAGGAATCACGAAACAG[G/A]TACACAGGCCTTCTTTTATTACTAACATCATTACTTCAAGACATTTATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link