slc25a36a

Ensembl ID:
ENSDARG00000038731
ZFIN ID:
ZDB-GENE-040718-415
Description:
Solute carrier family 25 member 36-A [Source:UniProtKB/Swiss-Prot;Acc:Q6DG32]
Human Orthologue:
SLC25A36
Human Description:
solute carrier family 25, member 36 [Source:HGNC Symbol;Acc:25554]
Mouse Orthologue:
Slc25a36
Mouse Description:
solute carrier family 25, member 36 Gene [Source:MGI Symbol;Acc:MGI:1924909]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11264 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11264
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007333 Essential Splice Site 248 311 7 7

The following transcripts of ENSDARG00000038731 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 39439033)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 39769198
GRCz11 2 39734837
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGCTTTGGTCTTTTTCTCTTTTCTCTCCCCCTTCTTTCTCCAATGACA[G/T]AGGTTATTCGTACCAGACTACGAGAGGAGGGCAGCAAGTATCGTTCGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Erectile dysfunction: Pilot genome-wide association search identifies potential loci for risk of erectile dysfunction in type 1 diabetes using the DCCT/EDIC study cohort. (View Study)
  • Normalized brain volume: Genome-wide association analysis of susceptibility and clinical phenotype in multiple sclerosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link