zgc:100957

Ensembl ID:
ENSDARG00000038716
ZFIN ID:
ZDB-GENE-040801-139
Description:
calsequestrin-like [Source:RefSeq peptide;Acc:NP_001003620]
Human Orthologue:
CASQ1
Human Description:
calsequestrin 1 (fast-twitch, skeletal muscle) [Source:HGNC Symbol;Acc:1512]
Mouse Orthologue:
Casq1
Mouse Description:
calsequestrin 1 Gene [Source:MGI Symbol;Acc:MGI:1309468]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19825 Nonsense Available for shipment Available now
sa9737 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19825
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056540 Nonsense 83 553 2 11
ENSDART00000075897 Nonsense 83 276 2 12
Genomic Location (Zv9):
Chromosome 2 (position 37749455)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38064369
GRCz11 2 38046697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTGAATACCAGTAAATGTTGTATTCTTTTGTTACACAGCTTGCTGCA[C/T]AAGTCCTGGCAGACTTTGACGATGAGGATATTGGAATTGGCCTACTCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056540 Essential Splice Site 206 553 5 11
ENSDART00000075897 Essential Splice Site 206 276 5 12
Genomic Location (Zv9):
Chromosome 2 (position 37751465)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38066379
GRCz11 2 38048707
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGGAGTTTCACCCACACATTAAGTTCTTTGCCACTTTTAATCCAAAG[G/A]TAATTTTTRTAATCTGCACAATTSTGTKTATGCATGGATGTACATRTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link