zgc:171687

Ensembl ID:
ENSDARG00000038682
ZFIN ID:
ZDB-GENE-071004-9
Description:
hypothetical protein LOC100126131 [Source:RefSeq peptide;Acc:NP_001103327]
Human Orthologues:
ANGPTL1, ANGPTL2, ANGPTL6, FGA
Human Descriptions:
angiopoietin-like 1 [Source:HGNC Symbol;Acc:489]
angiopoietin-like 2 [Source:HGNC Symbol;Acc:490]
angiopoietin-like 6 [Source:HGNC Symbol;Acc:23140]
fibrinogen alpha chain [Source:HGNC Symbol;Acc:3661]
Mouse Orthologues:
Angptl1, Angptl2, Angptl6, Fga
Mouse Descriptions:
angiopoietin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1919963]
angiopoietin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1347002]
angiopoietin-like 6 Gene [Source:MGI Symbol;Acc:MGI:1917976]
fibrinogen alpha chain Gene [Source:MGI Symbol;Acc:MGI:1316726]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32809 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32808 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32809
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056494 Essential Splice Site 68 241 3 6
Genomic Location (Zv9):
Chromosome 1 (position 59755852)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58216387
GRCz11 1 58913390
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTCAGATGGTCTCAGAAGGGAAAGATGAAGATAACGGAGGATGGACG[G/T]TATGAGTGTGACTATTAATCAAACACTCATCAGAACACACACAATGAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32808
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056494 Essential Splice Site 100 241 4 6
Genomic Location (Zv9):
Chromosome 1 (position 59755676)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58216211
GRCz11 1 58913214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGACTACAAGAGAGGATTCGGGAATGTGGAGGGAGAATACTGGCTGG[G/T]TGAGATCTGACATCCGTCTGTGTGTGTTCATGTCCAGTGATTGGTTCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link