zgc:158664

Ensembl ID:
ENSDARG00000038658
ZFIN IDs:
ZDB-GENE-050506-21, ZDB-GENE-070112-2082
Description:
Muscle-related coiled-coil protein [Source:UniProtKB/Swiss-Prot;Acc:A1L260]
Human Orthologue:
MURC
Human Description:
muscle-related coiled-coil protein [Source:HGNC Symbol;Acc:33742]
Mouse Orthologue:
Murc
Mouse Description:
muscle-related coiled-coil protein Gene [Source:MGI Symbol;Acc:MGI:1915266]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15351 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15351
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098354 Nonsense 305 329 2 2
ENSDART00000144716 Nonsense 340 364 2 2
Genomic Location (Zv9):
Chromosome 2 (position 42299445)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42348909
GRCz11 2 42198327
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGCTGTGACTCCACCCAAAGGCAGGAAGTCCAGCCCAGATGTGACCTA[C/A]ACAGAGGTGGTTACCGAAAACAAAAGGGAGGGTCCAGTATCAGAGRAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link