
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mpz
- Ensembl ID:
- ENSDARG00000038609
- ZFIN ID:
- ZDB-GENE-010724-4
- Description:
- myelin protein P0 [Source:RefSeq peptide;Acc:NP_919342]
- Human Orthologue:
- MPZ
- Human Description:
- myelin protein zero [Source:HGNC Symbol;Acc:7225]
- Mouse Orthologue:
- Mpz
- Mouse Description:
- myelin protein zero Gene [Source:MGI Symbol;Acc:MGI:103177]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa62 | Nonsense | Confirmed mutation in F2 line | During 2018 |
Mutation Details
- Allele Name:
- sa62
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056372 | Nonsense | 48 | 203 | 2 | 6 |
ENSDART00000109251 | Nonsense | 48 | 203 | 2 | 6 |
ENSDART00000132682 | Nonsense | 48 | 203 | 2 | 6 |
ENSDART00000136818 | None | 165 | None | 5 |
The following transcripts of ENSDARG00000038609 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 44341570)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 44427071 GRCz11 2 44280069 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGCATTGGTGGGCTCAGATGTCAGACTCTCCTGCTCTTTCTTCTCCTGG[C/T]AGTGGACTTCTCCAGAAGTGTCCTTTACATGGCATTACCGTCCAGATGGG
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: