ENSDARG00000038609 - Zebrafish Mutation Project

Search Zebrafish Mutation Project

e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457

You can look for mutant lines by browsing a complete list or by searching for a particular gene

mpz

Ensembl ID:: ENSDARG00000038609
ZFIN ID:: ZDB-GENE-010724-4
Description:: myelin protein P0 [Source:RefSeq peptide;Acc:NP_919342]
Human Orthologue:: MPZ
Human Description:: myelin protein zero [Source:HGNC Symbol;Acc:7225]
Mouse Orthologue:: Mpz
Mouse Description:: myelin protein zero Gene [Source:MGI Symbol;Acc:MGI:103177]

Alleles

There is 1 allele of this gene:

Allele name	Consequence	Status	Availability Estimate
sa62	Nonsense	Confirmed mutation in F2 line	During 2018

Mutation Details

Allele Name:: sa62
Current Status:: Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000056372	Nonsense	48	203	2	6
ENSDART00000109251	Nonsense	48	203	2	6
ENSDART00000132682	Nonsense	48	203	2	6
ENSDART00000136818		None	165	None	5

The following transcripts of ENSDARG00000038609 do not overlap with this mutation:

ENSDART00000137253

Genomic Location (Zv9):

Chromosome 2 (position 44341570)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	2	44427071
GRCz11	2	44280069

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

ATGCATTGGTGGGCTCAGATGTCAGACTCTCCTGCTCTTTCTTCTCCTGG[C/T]AGTGGACTTCTCCAGAAGTGTCCTTTACATGGCATTACCGTCCAGATGGG

Associated Phenotype:

Normal

Stage	Entity	Quality	Tag
Larval:Day 5 ZFS:0000037	whole organism ZFA:0001094	quality PATO:0000001	normal PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

More OMIM information for MPZ

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: