
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gnptg
- Ensembl ID:
- ENSDARG00000038566
- ZFIN ID:
- ZDB-GENE-040625-18
- Description:
- N-acetylglucosamine-1-phosphotransferase subunit gamma [Source:RefSeq peptide;Acc:NP_001002057]
- Human Orthologue:
- GNPTG
- Human Description:
- N-acetylglucosamine-1-phosphate transferase, gamma subunit [Source:HGNC Symbol;Acc:23026]
- Mouse Orthologue:
- Gnptg
- Mouse Description:
- N-acetylglucosamine-1-phosphotransferase, gamma subunit Gene [Source:MGI Symbol;Acc:MGI:2147006]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13050 | Nonsense | Available for shipment | Available now |
sa44180 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa13050
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056302 | Nonsense | 224 | 275 | 9 | 10 |
ENSDART00000141771 | Nonsense | 269 | 320 | 9 | 10 |
- Genomic Location (Zv9):
- Chromosome 24 (position 38857374)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 37456592 GRCz11 24 37344312 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCATCCGTTGTAAACAAGCGTGTYTGTTTTAACAGGACTTTGAAAAGCAG[C/T]GAACAGAGATCGAACGGCTTCAGTCACTCCTAAMACAACACAACATCTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44180
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056302 | Nonsense | 236 | 275 | 9 | 10 |
ENSDART00000141771 | Nonsense | 281 | 320 | 9 | 10 |
- Genomic Location (Zv9):
- Chromosome 24 (position 38857410)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 37456628 GRCz11 24 37344348 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTTTGAAAAGCAGCGAACAGAGATCGAACGGCTTCAGTCACTCCTAAAA[C/T]AACACAACATCTCCTATGAGGCGACAGCAGGTGAGACGCATACAAAGCTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: