zgc:172142

Ensembl ID:
ENSDARG00000038557
ZFIN ID:
ZDB-GENE-080204-51
Description:
ankyrin repeat and SAM domain-containing protein 3 [Source:RefSeq peptide;Acc:NP_001108037]
Human Orthologue:
ANKS3
Human Description:
ankyrin repeat and sterile alpha motif domain containing 3 [Source:HGNC Symbol;Acc:29422]
Mouse Orthologue:
Anks3
Mouse Description:
ankyrin repeat and sterile alpha motif domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1919865]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24546 Nonsense Available for shipment Available now
sa3261 Nonsense Available for shipment Available now
sa37949 Nonsense Mutation detected in F1 DNA During 2018
sa37948 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24546
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078828 Nonsense 201 622 5 14
ENSDART00000131342 Nonsense 201 622 6 16
Genomic Location (Zv9):
Chromosome 24 (position 39177515)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37786604
GRCz11 24 37674501
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCAGTCATTTTGATTGTGTGTATGATTCAGGGCGCGCGAACAAAGGAC[C/T]GAAACATGAAGGGAGAAACGGCGAGAGCTCTGGCTATGATGTACGGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078828 Nonsense 272 622 6 14
ENSDART00000131342 Nonsense 272 622 7 16
Genomic Location (Zv9):
Chromosome 24 (position 39177216)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37786305
GRCz11 24 37674202
KASP Assay ID:
554-2871.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCAGAACCAGAGGACCCAGCATTCACGATGGCCCACAGGCTATCGCA[C/T]GATTCAGAGTCGGATCCAAACACGGTAAATACTGGAGCAAACAAGGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078828 Nonsense 561 622 12 14
ENSDART00000131342 Nonsense 561 622 13 16
Genomic Location (Zv9):
Chromosome 24 (position 39168641)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37777730
GRCz11 24 37665627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGCAGACGCTGAACGCAAAACTACACACTCTACAGAACACGCACACA[C/T]AACTCAAACAGATCACACAGGATGACGGTCGATCTGTGGGAAAAGGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078828 Essential Splice Site 576 622 12 14
ENSDART00000131342 Essential Splice Site 576 622 13 16
Genomic Location (Zv9):
Chromosome 24 (position 39168594)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37777683
GRCz11 24 37665580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAACTCAAACAGATCACACAGGATGACGGTCGATCTGTGGGAAAAGG[T/C]GTGCAGAACCTAACAAAATTTACATTTAGTATCTAATGCAAAAAAAAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link