zgc:112185

Ensembl ID:
ENSDARG00000038556
ZFIN ID:
ZDB-GENE-050320-14
Description:
UPF0488 protein C8orf33 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q5BJC4]
Human Orthologue:
C8orf33
Human Description:
chromosome 8 open reading frame 33 [Source:HGNC Symbol;Acc:26104]
Mouse Orthologue:
1110038F14Rik
Mouse Description:
RIKEN cDNA 1110038F14 gene Gene [Source:MGI Symbol;Acc:MGI:2152337]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32497 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32497
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056283 Nonsense 78 215 3 5
ENSDART00000141414 Nonsense 90 227 3 5
Genomic Location (Zv9):
Chromosome 24 (position 39189183)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37798272
GRCz11 24 37686169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAACCTGTGTGTTAGACTCCAGATGAGCAGCTGAGTCGAGAGTTGGATT[G/A]GTGCATTGAACAGCTGGAGCTCGGCTTGAGAACTCAGAAAACATCCAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link