
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ccr12.3
- Ensembl ID:
- ENSDARG00000038541
- ZFIN ID:
- ZDB-GENE-060503-97
- Description:
- C-C chemokine receptor family-like [Source:RefSeq peptide;Acc:NP_001038492]
- Human Orthologue:
- XCR1
- Human Description:
- chemokine (C motif) receptor 1 [Source:HGNC Symbol;Acc:1625]
- Mouse Orthologue:
- Xcr1
- Mouse Description:
- chemokine (C motif) receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1346338]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33043 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa19895 | Nonsense | Available for shipment | Available now |
sa33042 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa33043
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056246 | None | 356 | None | 1 | |
ENSDART00000145888 | Essential Splice Site | None | 355 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 2 (position 50555563)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 50251095 GRCz11 2 49985325 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTCTAAGCTGCGGAGAGTTTCACACTCGCTCCTTTACTCAAGCCATCGG[T/C]GAGTGAAGCCAAACATATGATGATCTCAGAATAACCTCAATTTAAAGATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19895
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056246 | Nonsense | 75 | 356 | 1 | 1 |
ENSDART00000145888 | Nonsense | 74 | 355 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 2 (position 50555245)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 50250777 GRCz11 2 49985007 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAGCTTGCTTGGGAATGGACTGGTGCTGTGTATCATCTACAAGTTCGAG[A/T]AGCTCAGCACGGTCACCAATATCTTCTTACTCAACCTCGTGATATCAGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33042
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056246 | Nonsense | 214 | 356 | 1 | 1 |
ENSDART00000145888 | Nonsense | 213 | 355 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 2 (position 50554828)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 50250360 GRCz11 2 49984590 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTACAATCAGACATTCCTCACAAAGTGGGAGCTTATCGGCTATTATCAG[C/T]AGTTTTTCCTCTTCTTTATGGTTCCTCTGATTATCGTTTTGTACTGCTAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: