snap29

Ensembl ID:
ENSDARG00000038518
ZFIN ID:
ZDB-GENE-041111-226
Description:
Im:7145101 protein [Source:UniProtKB/TrEMBL;Acc:Q502H0]
Human Orthologue:
SNAP29
Human Description:
synaptosomal-associated protein, 29kDa [Source:HGNC Symbol;Acc:11133]
Mouse Orthologue:
Snap29
Mouse Description:
synaptosomal-associated protein 29 Gene [Source:MGI Symbol;Acc:MGI:1914724]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1919 Essential Splice Site F2 line generated During 2018
sa13359 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1919
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056208 Essential Splice Site 20 288 1 7
ENSDART00000141452   None 148 None 3
ENSDART00000143473 Essential Splice Site None 232 1 6
ENSDART00000148254 Essential Splice Site None 266 1 6
Genomic Location (Zv9):
Chromosome 8 (position 2022177)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 1834559
GRCz11 8 1839765
KASP Assay ID:
554-1908.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATAACAGGAGAACAGAACAGAACACTTCACCTCTTCCAGCGACCAAAG[G/T]TACAAATTCAGCGATAAAACGTTCAAAATATAGTTTGAGAGTTATGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13359
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056208 Nonsense 187 288 4 7
ENSDART00000141452 Nonsense 82 148 2 3
ENSDART00000143473 Nonsense 165 232 4 6
ENSDART00000148254 Nonsense 165 266 4 6
Genomic Location (Zv9):
Chromosome 8 (position 2031129)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 1843511
GRCz11 8 1848717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAGGCTACAGACGGCGCTTGCGGAGAGCAAACAGCAAGAAGACAAATA[T/A]CAGGCCAGTCAYCCAAACCTCAGGAAACTGGAAACATCTGGTAAACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link