zgc:110289

Ensembl ID:
ENSDARG00000038505
ZFIN ID:
ZDB-GENE-050417-66
Description:
hypothetical protein LOC550263 [Source:RefSeq peptide;Acc:NP_001017600]
Human Orthologue:
POLR2H
Human Description:
polymerase (RNA) II (DNA directed) polypeptide H [Source:HGNC Symbol;Acc:9195]
Mouse Orthologue:
Polr2h
Mouse Description:
polymerase (RNA) II (DNA directed) polypeptide H Gene [Source:MGI Symbol;Acc:MGI:2384309]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24215 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24215
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056188 Nonsense 111 150 4 5
Genomic Location (Zv9):
Chromosome 22 (position 39411235)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36558098
GRCz11 22 36527017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGGTTTATAGGATTGAAGGAGATGAAACGTCTACAGAAGCCGCCACA[C/T]GACTGTGAGTGTTGATTTATTTGCCTATTTACTACTTTTTTTTTTTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link