si:dkeyp-68b7.7

Ensembl ID:
ENSDARG00000038476
ZFIN ID:
ZDB-GENE-070912-672
Description:
Novel protein with a Zinc finger, C2H2 type domain [Source:UniProtKB/TrEMBL;Acc:B0S662]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17051 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17051
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063195 Nonsense 514 516 4 4
ENSDART00000132245   None 189 None 2
ENSDART00000140060 Nonsense 341 343 3 3
Genomic Location (Zv9):
Chromosome 2 (position 58712762)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 57779174
GRCz11 2 57893937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGACTGAGGGGTGCTGCACAAAACAAAGGGATTAAGGCCTTTTCACAC[C/T]AAGSAAGATAACAATAAATATAAGGCAAAAAAATCTTAAAATTCTAAWAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link