zgc:172057

Ensembl ID:
ENSDARG00000038458
ZFIN ID:
ZDB-GENE-080204-101
Description:
hypothetical protein LOC100005341 [Source:RefSeq peptide;Acc:NP_001121767]
Human Orthologues:
AC010336.1, AC092898.1, AC100783.1, WIPF1, WIPF2, WIPF3
Human Descriptions:
WAS/WASL interacting protein family, member 1 [Source:HGNC Symbol;Acc:12736]
WAS/WASL interacting protein family, member 2 [Source:HGNC Symbol;Acc:30923]
WAS/WASL interacting protein family, member 3 [Source:HGNC Symbol;Acc:22004]
Mouse Orthologues:
BC068157, Wipf1, Wipf2, Wipf3
Mouse Descriptions:
cDNA sequence BC068157 Gene [Source:MGI Symbol;Acc:MGI:3605626]
WAS/WASL interacting protein family, member 1 Gene [Source:MGI Symbol;Acc:MGI:2178801]
WAS/WASL interacting protein family, member 2 Gene [Source:MGI Symbol;Acc:MGI:1924462]
WAS/WASL interacting protein family, member 3 Gene [Source:MGI Symbol;Acc:MGI:3044681]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15485 Essential Splice Site Available for shipment Available now
sa21420 Essential Splice Site Available for shipment Available now
sa13422 Nonsense Available for shipment Available now
sa41337 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056123 Essential Splice Site 17 520 None 8
ENSDART00000139207 Essential Splice Site 17 520 None 7
Genomic Location (Zv9):
Chromosome 9 (position 2529154)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2457464
GRCz11 9 2507618
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTGGACCTCCACCWCCTCCGCCTGGACCTCCTCCTACCTTTTCTCAGG[T/C]ATCACATCATGGTTCAGATAAAGTAATRAAGTAAAAAGTTAAWGAACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056123 Essential Splice Site 105 520 4 8
ENSDART00000139207 Essential Splice Site 105 520 3 7
Genomic Location (Zv9):
Chromosome 9 (position 2528466)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2458152
GRCz11 9 2508306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAGGAGGAATGCCAAGGCTGAAATCAGCAGGAAACCGAGATGGCAATG[G/A]TAATCATCATCCTAACATTAATAGTCATTCAATAATACAGTAATACAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056123 Nonsense 195 520 5 8
ENSDART00000139207 Nonsense 195 520 4 7
Genomic Location (Zv9):
Chromosome 9 (position 2526030)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2460588
GRCz11 9 2510742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GWCCACAGGGTTCCTCACCYGCACCACCACCCCCAAACTCATCARGCAGA[C/T]GAAYWAGCTTTCCTCAACCTCCAAGGGARTCCCAGTCCTCCTTCCCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056123 Essential Splice Site 405 520 6 8
ENSDART00000139207 Essential Splice Site 405 520 5 7
Genomic Location (Zv9):
Chromosome 9 (position 2521813)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2464805
GRCz11 9 2514959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTCAAAGCCCTGTTTTTTAAAAGTTGGGTGATTGTTCTTTTGCTCCA[G/T]GTTCTCTTCCGCCTCCTCCACCTGCAGGAGGAAACAGAGGTGGAGCACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link