zgc:114150

Ensembl ID:
ENSDARG00000038456
ZFIN ID:
ZDB-GENE-050809-131
Description:
28S ribosomal protein S35, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q498P2]
Human Orthologue:
MRPS35
Human Description:
mitochondrial ribosomal protein S35 [Source:HGNC Symbol;Acc:16635]
Mouse Orthologue:
Mrps35
Mouse Description:
mitochondrial ribosomal protein S35 Gene [Source:MGI Symbol;Acc:MGI:2385255]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13848 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13848
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056121 Splice Site, Nonsense 247 330 7 8
Genomic Location (Zv9):
Chromosome 25 (position 2385685)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 2254391
GRCz11 25 2345627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTATGATTACGCCATGTACCTGCTGACCGTCCTCTACCACGAGTCCTG[G/A]GTGAGTWTTACATCCATCAACACAYRCTGAAATAAGATTATTATTTGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link