SPIRE1 (2 of 3)

Ensembl ID:
ENSDARG00000038445
Description:
spire homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:30622]
Human Orthologue:
SPIRE1
Human Description:
spire homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:30622]
Mouse Orthologue:
Spire1
Mouse Description:
spire homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1915416]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17650 Nonsense Available for shipment Available now
sa5897 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17650
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074718 Nonsense 188 206 6 6
ENSDART00000074718 Nonsense 188 206 6 6
Genomic Location (Zv9):
Chromosome 16 (position 56398603)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52909294
GRCz11 16 52795037
KASP Assay ID:
554-3897.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGCATTTATTCTTTGATAWTTCTGTATTTRMAGTTGTRCTTYTGCTGT[C/T]GAACAAAGCRTTTTTCCCTCTTTACCYGGTCCTACACCTGTCAGTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074718 Nonsense 188 206 6 6
ENSDART00000074718 Nonsense 188 206 6 6
Genomic Location (Zv9):
Chromosome 16 (position 56398603)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52909294
GRCz11 16 52795037
KASP Assay ID:
554-3897.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGCATTTATTCTTTGATAWTTCTGTATTTRCAGTTGTGCTTYTGCTGT[C/T]GAACAAAGCGTTTTTCCCTCTTTACCTGGTCCTACACCTGTCAGTTTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link