
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
csrnp1b
- Ensembl ID:
- ENSDARG00000038429
- ZFIN ID:
- ZDB-GENE-030131-1515
- Description:
- cysteine/serine-rich nuclear protein 1 [Source:RefSeq peptide;Acc:NP_955913]
- Human Orthologue:
- CSRNP1
- Human Description:
- cysteine-serine-rich nuclear protein 1 [Source:HGNC Symbol;Acc:14300]
- Mouse Orthologue:
- Csrnp1
- Mouse Description:
- cysteine-serine-rich nuclear protein 1 Gene [Source:MGI Symbol;Acc:MGI:2387989]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18280 | Nonsense | Available for shipment | Available now |
sa44119 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa39443 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa18280
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056082 | Nonsense | 246 | 433 | 4 | 6 |
ENSDART00000109107 | Nonsense | 246 | 566 | 4 | 5 |
ENSDART00000135405 | None | 201 | None | 4 |
The following transcripts of ENSDARG00000038429 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 24 (position 20258162)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 19564316 GRCz11 24 19708735 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGCTTCTGTGAGCCAGAGACCTGCAGCTGTAGTTTGGCTGGGATCAAATG[T/A]CAGGTAAGCAATTCCCAACAGACTTCTTTGAGAACATCAYYTACCAAGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44119
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056082 | Nonsense | 331 | 433 | 5 | 6 |
ENSDART00000109107 | Nonsense | 331 | 566 | 5 | 5 |
ENSDART00000135405 | None | 201 | None | 4 |
The following transcripts of ENSDARG00000038429 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 24 (position 20257795)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 19563949 GRCz11 24 19708368 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGCAGAGATCAGCAGCACGCCAGACATGCCAACATTTCACTTTAACTCA[G/T]AGCTACTATCCACAGGAGAGAACAGCTGCAGCAGTGACATGACCGATTCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39443
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000056082 | None | 433 | None | 6 | |
ENSDART00000109107 | Nonsense | 495 | 566 | 5 | 5 |
ENSDART00000135405 | None | 201 | None | 4 |
The following transcripts of ENSDARG00000038429 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 24 (position 20257301)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 19563455 GRCz11 24 19707874 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACTTAGAATTCTTTGATGGATTTCCTTGTTTGGGACCGAGCTCGCTATA[C/A]AACTCCCTAAAGGAGTATGAGCACGTGGACAACTTCTTTCAGTTCCAGTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: