zgc:112180

Ensembl ID:
ENSDARG00000038401
ZFIN ID:
ZDB-GENE-050522-224
Description:
thyrotroph embryonic factor 2 [Source:RefSeq peptide;Acc:NP_001018497]
Human Orthologue:
TEF
Human Description:
thyrotrophic embryonic factor [Source:HGNC Symbol;Acc:11722]
Mouse Orthologue:
Tef
Mouse Description:
thyrotroph embryonic factor Gene [Source:MGI Symbol;Acc:MGI:98663]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39977 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122388 Nonsense 42 309 2 5
Genomic Location (Zv9):
Chromosome 3 (position 5655978)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5153352
GRCz11 3 5063193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTTCATCTGTATACATATAACTAAAGTCTGCTTTTCCTCTTAGATATC[G/T]AGAAGGAGAAGCAGGCCTCTGCTGGCGATGGGGCGTCCGCTGGCAGCGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link