zgc:92878

Ensembl ID:
ENSDARG00000038399
ZFIN ID:
ZDB-GENE-040718-179
Description:
DNA-directed RNA polymerase III subunit RPC8 [Source:RefSeq peptide;Acc:NP_001002476]
Human Orthologue:
POLR3H
Human Description:
polymerase (RNA) III (DNA directed) polypeptide H (22.9kD) [Source:HGNC Symbol;Acc:30349]
Mouse Orthologue:
Polr3h
Mouse Description:
polymerase (RNA) III (DNA directed) polypeptide H Gene [Source:MGI Symbol;Acc:MGI:1926179]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19932 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19932
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056037 Nonsense 141 214 5 6
Genomic Location (Zv9):
Chromosome 3 (position 5697604)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5111726
GRCz11 3 5021567
KASP Assay ID:
2259-2985.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTGTGGGTCTGGGAGTACGAGACGGACGAGGGCACTCATGACCTCTA[C/A]ATGGACCAGGGTGAGGAGATCCGCTTCCGGGTCACAGACGAGGTGTTCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link