
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:153477
- Ensembl ID:
- ENSDARG00000038374
- ZFIN ID:
- ZDB-GENE-060929-1206
- Description:
- coiled-coil domain-containing protein 137 [Source:RefSeq peptide;Acc:NP_001070224]
- Human Orthologue:
- CCDC137
- Human Description:
- coiled-coil domain containing 137 [Source:HGNC Symbol;Acc:33451]
- Mouse Orthologue:
- Ccdc137
- Mouse Description:
- coiled-coil domain containing 137 Gene [Source:MGI Symbol;Acc:MGI:1914541]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12437 | Nonsense | Available for shipment | Available now |
sa33100 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa12437
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081304 | Nonsense | 38 | 242 | 2 | 6 |
ENSDART00000122475 | Nonsense | 109 | 313 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 3 (position 12364939)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 12750710 GRCz11 3 12902159 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAAAAATGCTGACCCTGGATCAGACGAYCACCTCAATCAGATTCCTCAT[C/T]GATTACGAGAAATCATGAAGAGTAAGGAAAGGATGAAGCAGGGCTTTAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33100
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081304 | Essential Splice Site | 58 | 242 | 2 | 6 |
ENSDART00000122475 | Essential Splice Site | 129 | 313 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 3 (position 12365003)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 12750646 GRCz11 3 12902095 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATGAAGAGTAAGGAAAGGATGAAGCAGGGCTTTAAAAAGAAGAAAAAAG[G/A]TACTGCTTAGTCTTATTTTCTCATCTATCTGAGTGGTTTATTTTGTTATT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: