zgc:153477

Ensembl ID:
ENSDARG00000038374
ZFIN ID:
ZDB-GENE-060929-1206
Description:
coiled-coil domain-containing protein 137 [Source:RefSeq peptide;Acc:NP_001070224]
Human Orthologue:
CCDC137
Human Description:
coiled-coil domain containing 137 [Source:HGNC Symbol;Acc:33451]
Mouse Orthologue:
Ccdc137
Mouse Description:
coiled-coil domain containing 137 Gene [Source:MGI Symbol;Acc:MGI:1914541]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12437 Nonsense Available for shipment Available now
sa33100 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12437
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081304 Nonsense 38 242 2 6
ENSDART00000122475 Nonsense 109 313 2 6
Genomic Location (Zv9):
Chromosome 3 (position 12364939)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12750710
GRCz11 3 12902159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAAATGCTGACCCTGGATCAGACGAYCACCTCAATCAGATTCCTCAT[C/T]GATTACGAGAAATCATGAAGAGTAAGGAAAGGATGAAGCAGGGCTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33100
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081304 Essential Splice Site 58 242 2 6
ENSDART00000122475 Essential Splice Site 129 313 2 6
Genomic Location (Zv9):
Chromosome 3 (position 12365003)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12750646
GRCz11 3 12902095
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGAAGAGTAAGGAAAGGATGAAGCAGGGCTTTAAAAAGAAGAAAAAAG[G/A]TACTGCTTAGTCTTATTTTCTCATCTATCTGAGTGGTTTATTTTGTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link