zgc:162815

Ensembl ID:
ENSDARG00000038369
ZFIN ID:
ZDB-GENE-070424-41
Description:
cytochrome P450-like [Source:RefSeq peptide;Acc:NP_001036243]
Human Orthologue:
CYP2W1
Human Description:
cytochrome P450, family 2, subfamily W, polypeptide 1 [Source:HGNC Symbol;Acc:20243]
Mouse Orthologue:
Cyp2w1
Mouse Description:
cytochrome P450, family 2, subfamily w, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3616076]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13143 Nonsense Available for shipment Available now
sa7539 Missense Mutation detected in F1 DNA During 2018
sa16722 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13143
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055971 Nonsense 155 503 3 9
Genomic Location (Zv9):
Chromosome 3 (position 12507786)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12607863
GRCz11 3 12759312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTWTWAGCAACCTGCGAGACTTTGGGATGGGCAAAAGAGGGAGCGAAGMG[A/T]AAATCATTGAAGAAATTCWTCATCTCAAAGGAGAATTTGATAAGTTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7539
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055971 Missense 311 503 6 9
Genomic Location (Zv9):
Chromosome 3 (position 12504958)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12610691
GRCz11 3 12762140
KASP Assay ID:
554-4341.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATGCAGAGAATCTTCTCATGACRGTGGGAAATCTGTTTGCTGCTGGT[A/G]CTGATACYACAGGAACAACTCTGCGCTGGGGTCTGATGCTCATGGCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16722
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055971 Essential Splice Site 333 503 7 9
Genomic Location (Zv9):
Chromosome 3 (position 12504809)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12610840
GRCz11 3 12762289
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTGAAYACATTGTAGGWCAAAGCACCAAATATGTNNTGCATTTGTGGGC[A/T]GATCGAGTTCAAGAGGWGATTGAYRGAGTGATTGGTGGACGWCAGCCGGY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link