zgc:66268

Ensembl ID:
ENSDARG00000038366
ZFIN ID:
ZDB-GENE-040426-1584
Description:
hypothetical protein LOC393484 [Source:RefSeq peptide;Acc:NP_956806]
Human Orthologue:
CYP2W1
Human Description:
cytochrome P450, family 2, subfamily W, polypeptide 1 [Source:HGNC Symbol;Acc:20243]
Mouse Orthologue:
Cyp2w1
Mouse Description:
cytochrome P450, family 2, subfamily w, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3616076]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9457 Nonsense Available for shipment Available now
sa26005 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9457
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055972 Nonsense 335 455 7 9
Genomic Location (Zv9):
Chromosome 3 (position 12553526)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12562123
GRCz11 3 12713572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAYAYATTGTAGATCAAAGCACCAAATATGTGTTGCATTTGTGTGCAGAT[C/T]GAGTTCAAGMGGAGATTGACAGAGTGATTGGTGGACGTCAGCCRGYGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055972 Nonsense 412 455 8 9
Genomic Location (Zv9):
Chromosome 3 (position 12553083)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12562566
GRCz11 3 12714015
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGGACCACTGTTATTCCTCTGCTGACGTCTGTTCTGAAGGATGAAAGT[G/T]AATGGGAGAAACCAAACAGCTTTTACCCAGAACACTTCCTTGATGAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link