zgc:101609

Ensembl ID:
ENSDARG00000038360
ZFIN ID:
ZDB-GENE-041114-170
Description:
probable tRNA(His) guanylyltransferase [Source:RefSeq peptide;Acc:NP_001007456]
Human Orthologue:
THG1L
Human Description:
tRNA-histidine guanylyltransferase 1-like (S. cerevisiae) [Source:HGNC Symbol;Acc:26053]
Mouse Orthologue:
Thg1l
Mouse Description:
tRNA-histidine guanylyltransferase 1-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913878]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15251 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15251
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055961 Nonsense 212 269 5 6
Genomic Location (Zv9):
Chromosome 14 (position 6505974)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6233361
GRCz11 14 6540088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATATCAATTACAATAACGAGTCCTCTGTRTATAAAAAAGGCACAACTT[T/A]AATATGGGAAAAGGTANNNNNNAGCTRGCAAMAACAAATTATKTTATCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link