zgc:153148

Ensembl ID:
ENSDARG00000038359
ZFIN ID:
ZDB-GENE-060929-780
Description:
enolase superfamily 1 [Source:RefSeq peptide;Acc:NP_001070210]
Human Orthologue:
ENOSF1
Human Description:
enolase superfamily member 1 [Source:HGNC Symbol;Acc:30365]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31608 Essential Splice Site Available for shipment Available now
sa21100 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055956 Essential Splice Site 102 441 None 15
ENSDART00000098412 Essential Splice Site 102 308 None 12
ENSDART00000135068 Essential Splice Site 102 205 None 8

The following transcripts of ENSDARG00000038359 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 58376466)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56811792
GRCz11 7 57113203
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCGAGGCTTCTACAGACTCCTGAGCAGCGATGGTCAGATGAGATGGG[T/A]AAGAGAGACACACTGAGTGCAGACCCTTCAGTTCATTAACAGCTAAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21100
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055956 Essential Splice Site 178 441 None 15
ENSDART00000098412 Essential Splice Site 178 308 None 12
ENSDART00000135068 Essential Splice Site 178 205 None 8

The following transcripts of ENSDARG00000038359 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 58378850)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56814176
GRCz11 7 57115587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTTTTAGATATATTGGTAAAAGGCAAAAAAGATCAGAAAAGTAGAGG[T/C]AAGAACCGTTGTTTAGACATCACTGAAGTCCTTACATGAACTACAGTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link