zgc:194409

Ensembl ID:
ENSDARG00000038315
ZFIN ID:
ZDB-GENE-080723-69
Description:
pyridoxal phosphate phosphatase [Source:RefSeq peptide;Acc:NP_001122177]
Human Orthologue:
PDXP
Human Description:
pyridoxal (pyridoxine, vitamin B6) phosphatase [Source:HGNC Symbol;Acc:30259]
Mouse Orthologue:
Pdxp
Mouse Description:
pyridoxal (pyridoxine, vitamin B6) phosphatase Gene [Source:MGI Symbol;Acc:MGI:1919282]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21631 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21631
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055882 Nonsense 111 308 1 2
Genomic Location (Zv9):
Chromosome 10 (position 2709027)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2654664
GRCz11 10 2681835
KASP Assay ID:
2260-2741.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCCGCTGCTTACCTGCGGGACGTGGCGCGGCTGCAGGGGAAGGTGTA[C/A]GCGATCGGCGGCGGCGGTGTGCTGAAGGAGCTGCGGGACGCCGGGGTGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link