zgc:55536

Ensembl ID:
ENSDARG00000038308
ZFIN ID:
ZDB-GENE-040426-733
Description:
Synaptobrevin homolog YKT6 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUN8]
Human Orthologue:
YKT6
Human Description:
YKT6 v-SNARE homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:16959]
Mouse Orthologue:
Ykt6
Mouse Description:
YKT6 homolog (S. Cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1927550]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21635 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21635
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055869 Nonsense 23 198 2 8
ENSDART00000131505 Nonsense 23 199 2 8
Genomic Location (Zv9):
Chromosome 10 (position 2870219)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2815856
GRCz11 10 2843027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTCTTGCATAAAGGCTCAACGAAGGCCAACCTGCTGAAGGCGGCGTA[C/A]GATCTGTCATCGTTCAGTTTCTTCCAGAGATCCAGGTACAACCTCAGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link