VGLL3

Ensembl ID:
ENSDARG00000038305
Description:
vestigial like 3 (Drosophila) [Source:HGNC Symbol;Acc:24327]
Human Orthologue:
VGLL3
Human Description:
vestigial like 3 (Drosophila) [Source:HGNC Symbol;Acc:24327]
Mouse Orthologue:
Vgll3
Mouse Description:
vestigial like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920819]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14796 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14796
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099440 Nonsense 116 330 2 4
Genomic Location (Zv9):
Chromosome 9 (position 19631992)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 19006234
GRCz11 9 19013946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCCGCCGACGCCGAGTACTTRAGTGCCAGGTGTGTGGTCTTCACCTA[T/G]TTTCGTGGAGACATCGGGGATGTGGTGGACGAGCATTTCTCACGCGCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link