zgc:103559

Ensembl ID:
ENSDARG00000038293
ZFIN ID:
ZDB-GENE-041212-22
Description:
hypothetical protein LOC494056 [Source:RefSeq peptide;Acc:NP_001008599]
Human Orthologues:
CRMP1, DPYS, DPYSL2, DPYSL3, DPYSL4, DPYSL5
Human Descriptions:
collapsin response mediator protein 1 [Source:HGNC Symbol;Acc:2365]
dihydropyrimidinase [Source:HGNC Symbol;Acc:3013]
dihydropyrimidinase-like 2 [Source:HGNC Symbol;Acc:3014]
dihydropyrimidinase-like 3 [Source:HGNC Symbol;Acc:3015]
dihydropyrimidinase-like 4 [Source:HGNC Symbol;Acc:3016]
dihydropyrimidinase-like 5 [Source:HGNC Symbol;Acc:20637]
Mouse Orthologues:
Crmp1, Dpys, Dpysl2, Dpysl3, Dpysl4, Dpysl5
Mouse Descriptions:
collapsin response mediator protein 1 Gene [Source:MGI Symbol;Acc:MGI:107793]
dihydropyrimidinase Gene [Source:MGI Symbol;Acc:MGI:1928679]
dihydropyrimidinase-like 2 Gene [Source:MGI Symbol;Acc:MGI:1349763]
dihydropyrimidinase-like 3 Gene [Source:MGI Symbol;Acc:MGI:1349762]
dihydropyrimidinase-like 4 Gene [Source:MGI Symbol;Acc:MGI:1349764]
dihydropyrimidinase-like 5 Gene [Source:MGI Symbol;Acc:MGI:1929772]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38551 Essential Splice Site Mutation detected in F1 DNA During 2018
sa25338 Essential Splice Site Mutation detected in F1 DNA During 2018
sa20703 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055848 Essential Splice Site 50 459 2 11
Genomic Location (Zv9):
Chromosome 6 (position 26845782)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27146993
GRCz11 6 27137554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTAACAGATTACTTCAATAGTTTGATAATACAACAGCATCTTTATAAC[A/T]GGTACTGGATGTGGGTGACAGTCTGATAATGCCAGGTATAGTGGACAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055848 Essential Splice Site 139 459 4 11
Genomic Location (Zv9):
Chromosome 6 (position 26844823)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27146034
GRCz11 6 27136595
KASP Assay ID:
554-7541.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAAACTTGCCTTTTTCTGCCCATCATATTGTTTTTTTTTTTCTGTCAC[A/T]GATGGAGTTAAAGCCGATGTGCCAAGCTGGTGTGGCTGGATTTAAGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20703
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055848 Nonsense 283 459 7 11
Genomic Location (Zv9):
Chromosome 6 (position 26841521)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27142732
GRCz11 6 27133293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCACCACTACCTTAACCTGTCAGCAGAGGACATTCCAGGACGGGCCACT[C/T]AATTCAAATGCTGCCCCCCGATACGGGGCACGGCCAACCAGGTGTCCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link