thoc5

Ensembl ID:
ENSDARG00000038290
ZFIN ID:
ZDB-GENE-030131-3789
Description:
THO complex subunit 5 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6NY52]
Human Orthologue:
THOC5
Human Description:
THO complex 5 [Source:HGNC Symbol;Acc:19074]
Mouse Orthologue:
Thoc5
Mouse Description:
THO complex 5 Gene [Source:MGI Symbol;Acc:MGI:1351333]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37987 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37988 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055845 Essential Splice Site None 684 1 20
ENSDART00000126611   None 705 None 20
Genomic Location (Zv9):
Chromosome 25 (position 3816238)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3634163
GRCz11 25 3759822
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAAATTCACGTTTAAATAACACAGTAGGACAAATTCAGTCAATAAAGG[T/G]GAGGTTTATGCTTTCTTTTTTATCTAGGCGTCTTATTTGAACACAACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055845 Essential Splice Site 323 684 10 20
ENSDART00000126611 Essential Splice Site 344 705 10 20
Genomic Location (Zv9):
Chromosome 25 (position 3830963)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3648888
GRCz11 25 3774547
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGATGATGAAAGTGATTCAGATGCGGAAGAGGAGCAGCAGAACACGG[T/C]CAGGCTGCGTTTTTATGTCCTCCATGTTTATTATCTTCTAGCTGATGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link