zgc:113293

Ensembl ID:
ENSDARG00000038271
ZFIN ID:
ZDB-GENE-050417-453
Description:
Zgc:113293 [Source:UniProtKB/TrEMBL;Acc:Q566N1]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39734 Nonsense Mutation detected in F1 DNA During 2018
sa39735 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39734
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101071 Nonsense 11 245 1 6
Genomic Location (Zv9):
Chromosome 2 (position 250504)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 217172
GRCz11 2 206083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGTGTGCAGGACCACAATGCATCTCAACACTTTGTGTTTCCTTTATT[T/A]ACTGCTCGGTAAGTTCATTAATCTGTAATTAATTGAGAAAGTGTATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39735
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101071 Essential Splice Site 128 245 2 6
Genomic Location (Zv9):
Chromosome 2 (position 251638)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 218306
GRCz11 2 207217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGGTAGCAGGAACACCTTCAACAAGAGCTTCAGTCTCAGAGTCTACGG[T/C]GAGCAGAAGCCATCTCACAACTCTATTTGTTTAATGATATGCTTTAAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link