wu:fc59a02

Ensembl ID:
ENSDARG00000038237
ZFIN ID:
ZDB-GENE-030131-3920
Human Orthologue:
TBC1D12
Human Description:
TBC1 domain family, member 12 [Source:HGNC Symbol;Acc:29082]
Mouse Orthologue:
Tbc1d12
Mouse Description:
TBC1D12: TBC1 domain family, member 12 Gene [Source:MGI Symbol;Acc:MGI:2384803]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15150 Nonsense Available for shipment Available now
sa36401 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15150
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055756 Nonsense 206 823 1 13
Genomic Location (Zv9):
Chromosome 17 (position 23084056)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23234205
GRCz11 17 23254229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGAGCCTTGGGTGGCCTTCCTGCTCCAGAACGCCCTGTCTTTGTTCAT[C/T]AGAGCGATGGTGTCCTCTCSTCTGGGAGGTCATGTGAAAGGGTCAGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055756 Essential Splice Site 442 823 3 13
Genomic Location (Zv9):
Chromosome 17 (position 23075809)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23225958
GRCz11 17 23245982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTTGAGCCTTTGTCCACCACCGCTCTTATTCTGGAAGACAGACCTGC[G/A]TAAGTGTGAAACGTGAAGTTCAGCTCCCATAATGCATTGCTTAAACTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link