SPOP_DANRE

Ensembl ID:
ENSDARG00000038215
Description:
Speckle-type POZ protein [Source:UniProtKB/Swiss-Prot;Acc:Q7T330]
Human Orthologue:
SPOP
Human Description:
speckle-type POZ protein [Source:HGNC Symbol;Acc:11254]
Mouse Orthologues:
AC132362.1, Gm10696, Gm10697, Gm4778, Gm4858, Gm5286, Gm5773, Gm5852, Gm9116, Gm9117, Gm9125, Spop, Tdpoz1, Tdpoz3, Tdpoz4, Tdpoz5
Mouse Descriptions:
predicted gene 10696 Gene [Source:MGI Symbol;Acc:MGI:3702972]
predicted gene 10697 Gene [Source:MGI Symbol;Acc:MGI:3710527]
predicted gene 4778 Gene [Source:MGI Symbol;Acc:MGI:3643869]
predicted gene 4858 Gene [Source:MGI Symbol;Acc:MGI:3645677]
predicted gene 5286 Gene [Source:MGI Symbol;Acc:MGI:3644284]
predicted gene 5852 Pseudogene [Source:MGI Symbol;Acc:MGI:3643132]
predicted gene 9116 Pseudogene [Source:MGI Symbol;Acc:MGI:3648187]
predicted gene 9125 Gene [Source:MGI Symbol;Acc:MGI:3702970]
predicted pseudogene 5773 Pseudogene [Source:MGI Symbol;Acc:MGI:3645792]
predicted pseudogene 9117 Pseudogene [Source:MGI Symbol;Acc:MGI:3704095]
speckle-type POZ protein Gene [Source:MGI Symbol;Acc:MGI:1343085]
TD and POZ domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2449436]
TD and POZ domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:3027903]
TD and POZ domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:3027904]
TD and POZ domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:3027905]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18300 Nonsense Available for shipment Available now
sa40045 Nonsense Mutation detected in F1 DNA During 2018
sa9950 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016612 Nonsense 44 374 4 12
Genomic Location (Zv9):
Chromosome 3 (position 20703765)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 20567942
GRCz11 3 20717682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGTGGTTAAGTTCTCCTATATGTGGACCATCAACAACTTCAGCTTCTG[T/A]CGGGAGGAGATGGGAGAGGWCATCAAAAGCTCCACCTTCTCCTCGGGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40045
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016612 Nonsense 70 374 5 12
Genomic Location (Zv9):
Chromosome 3 (position 20703597)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 20567774
GRCz11 3 20717514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCAGAATAAATGCTTATGTGAGGCTCTTTGTTTTGAACAGGTGTTTA[C/T]GAGTGAATCCTAAAGGGCTGGATGAGGAGAGTAAAGATTATCTGTCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9950
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016612 Nonsense 165 374 7 12
Genomic Location (Zv9):
Chromosome 3 (position 20663678)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 20527640
GRCz11 3 20677380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATWAAAATGTCTTTTTTNCTCTTTTGTGTGTTCAGGTGAGTGTGGTR[C/T]AGGACTCAGTGAACATCTCTGGGCAGAACACAATGAACATGGTGAAGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link