slc35b1

Ensembl ID:
ENSDARG00000038213
ZFIN ID:
ZDB-GENE-040912-148
Description:
Solute carrier family 35 member B1 [Source:UniProtKB/Swiss-Prot;Acc:Q66HX0]
Human Orthologue:
SLC35B1
Human Description:
solute carrier family 35, member B1 [Source:HGNC Symbol;Acc:20798]
Mouse Orthologue:
Slc35b1
Mouse Description:
solute carrier family 35, member B1 Gene [Source:MGI Symbol;Acc:MGI:1343133]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19986 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19986
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055722 Essential Splice Site 226 329 6 9

The following transcripts of ENSDARG00000038213 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 21061044)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 20820781
GRCz11 3 20970521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATGATGCTGAACGTTAACATGTGGTCCACGCTGGTCCTAGGAATAGG[T/C]GAGTTATTACACAAGAGGTTGTATAAAATTAGAGTCACTTTACTAGTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link