zgc:158626

Ensembl ID:
ENSDARG00000038166
ZFIN ID:
ZDB-GENE-070112-2372
Description:
hypothetical protein LOC791189 [Source:RefSeq peptide;Acc:NP_001074140]
Mouse Orthologue:
Hyal6
Mouse Description:
hyaluronoglucosaminidase 6 Gene [Source:MGI Symbol;Acc:MGI:1921659]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44320 Nonsense Mutation detected in F1 DNA During 2018
sa44319 Nonsense Mutation detected in F1 DNA During 2018
sa17541 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073511 Nonsense 24 486 2 5

The following transcripts of ENSDARG00000038166 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 28476597)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27166691
GRCz11 25 27609893
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGGTGGCAGTGTGTGGATTGCTGGTTGCTTGGGCCGATCAGTTGAAG[C/T]AAGCTCGGACGCCATTGTTACCTCATCGCCCATTTGTGGTGGTGTGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44319
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073511 Nonsense 222 486 3 5

The following transcripts of ENSDARG00000038166 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 28472143)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27162237
GRCz11 25 27605439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTTCCTGACTGTTACAACTACGGTTACAAGCAGCATCCATTGCGTTA[T/G]ACAGGAGAGTGTCCTAATATAGAGCATGTACGCAATGACCATCTGATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073511 Nonsense 297 486 3 5

The following transcripts of ENSDARG00000038166 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 28471918)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27162012
GRCz11 25 27605214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAGGAATGACTATACACTGCCWGTTTTTGTTTACTCCAGAMCCTTCTA[T/A]GCATACACGTTTGTTGTCCTATCAGAGGTAAGTAGATTATTGGAGTTYCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link